View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9551_1D_low_52 (Length: 208)
Name: NF9551_1D_low_52
Description: NF9551_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9551_1D_low_52 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 150; Significance: 2e-79; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 8 - 205
Target Start/End: Complemental strand, 4708361 - 4708164
Alignment:
| Q |
8 |
atgaaaaccttaatggtatagaatccatgaccannnnnnnnaaagaagaatccatgataattttgcagatagtcgttgacgccctaattgatcctaaagt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||| || ||||||||||||||||| ||||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
4708361 |
atgaaaaccttaatggtatagaatccatgatcattttttttaaagaagaatccatgatcattttgcagatagtcgttgacaccctacttgatcctaaagt |
4708262 |
T |
 |
| Q |
108 |
ggttataagatatgacccaaagtcactggttagagatcttgctgacctaatagagagatacacgaagtcgcaggttactggctgaaacatacttttga |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
4708261 |
ggttataagatatgacccaaagtcactggttagagatcttgctgacctaatagagagatacacgaagtcgcaagttactggctgaatcatacttttga |
4708164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 69 - 184
Target Start/End: Complemental strand, 4745984 - 4745869
Alignment:
| Q |
69 |
tttgcagatagtcgttgacgccctaattgatcctaaagtggttataagatatgacccaaagtcactggttagagatcttgctgacctaatagagagatac |
168 |
Q |
| |
|
|||||||||||| |||||| ||||| ||||||||||||||| ||||| |||||| |||||||||||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
4745984 |
tttgcagatagttgttgactccctacttgatcctaaagtgggtataatatatgatccaaagtcactgattagagctcttgctgacctaatagagagatac |
4745885 |
T |
 |
| Q |
169 |
acgaagtcgcaggtta |
184 |
Q |
| |
|
| |||||||| |||| |
|
|
| T |
4745884 |
ataaagtcgcatgtta |
4745869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University