View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9551_2D_high_3 (Length: 269)
Name: NF9551_2D_high_3
Description: NF9551_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9551_2D_high_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 1 - 267
Target Start/End: Original strand, 13280853 - 13281119
Alignment:
| Q |
1 |
aaactcgatgttgatatactaattgttttctacggcccgttgagttctgaggtgcacttggatggagtgtgtcactggttgcgaaggataaatgataaaa |
100 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13280853 |
aaactcgatgttgatataccaattgttttctacggcccgttgagttctgaggtgtacttggatggagtgtgtcactggttgcgaaggataaatgataaaa |
13280952 |
T |
 |
| Q |
101 |
ctgatgttgtgtcattcaacttgagcaatgaagtgtttttcacaacacccttagacatacatggtgatgtttgtttggttgtgttaaatgggtcagttgc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13280953 |
ctgatgttgtgtcattcaacttgagcaatgaagtgtttttcacaacacccttagacatacatggtgatgtttgtttggttgtgttaaatgggtcagttgc |
13281052 |
T |
 |
| Q |
201 |
tataatctcatattataaagggtcaaggtatttcagcatatcaattttgggtgaaattggtgttaaa |
267 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13281053 |
tataatctcatattacaaagggtcaaggtatttcagcatatcaattttgggtgaaattggtgttaaa |
13281119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 105 - 149
Target Start/End: Complemental strand, 27230488 - 27230444
Alignment:
| Q |
105 |
tgttgtgtcattcaacttgagcaatgaagtgtttttcacaacacc |
149 |
Q |
| |
|
|||||||||||| ||||||| |||||| ||||||||||| ||||| |
|
|
| T |
27230488 |
tgttgtgtcatttaacttgaccaatgatgtgtttttcactacacc |
27230444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University