View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9551_2D_low_8 (Length: 440)
Name: NF9551_2D_low_8
Description: NF9551_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9551_2D_low_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 366; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 366; E-Value: 0
Query Start/End: Original strand, 41 - 430
Target Start/End: Complemental strand, 52512312 - 52511923
Alignment:
| Q |
41 |
gagcacaaggatatgaatgctctcatgctcaagacactttttacaggaggagaattttataacgctgaaaattatcctaactttggagacacaagtattc |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52512312 |
gagcacaaggatatgaatgctctcatgctcaagacactttttacaggaggagaattttataacgctgaaaattatcctaactttggagacacaagtattc |
52512213 |
T |
|
| Q |
141 |
caactccaagtagaggcaacaataatattagtagccagattcacccgagcatcgatatatcaaacttgaatcattactcgtcttcgtcttctaccacatc |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||| |
|
|
| T |
52512212 |
caactccaagtagaggcaacaataatattagtagccagattcacccgagcatcgatatatcaaacttgaaccattactcgtcttcgtctgctaccacatc |
52512113 |
T |
|
| Q |
241 |
cttggatatgaacatgcagtcattacatctattaactaattcatcaacatcatttagtgctaatttacaagaccatcatcatagtagatttactactcat |
340 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52512112 |
cttggatatgaacatgcagtcattagatctattaactaattcatcaacatcatttagtgctaatttacaagaccatcatcatagtagatttactactcat |
52512013 |
T |
|
| Q |
341 |
gatcatgacaacctttcttttcatcttcatcttatgcagcaccaccaccccacgaacatgtcctcttctactaactctattcatatcagt |
430 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
52512012 |
gatcatgacaacctttcttttcatcttcatcctatgcaacaccaccaccccacgaacatgtcctcttctactaactctattcatgtcagt |
52511923 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 19 - 48
Target Start/End: Complemental strand, 34879865 - 34879836
Alignment:
| Q |
19 |
atcttgttaatgcaaaatatgagagcacaa |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
34879865 |
atcttgttaatgcaaaatatgagagcacaa |
34879836 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University