View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9551_high_5 (Length: 295)
Name: NF9551_high_5
Description: NF9551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9551_high_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 20 - 289
Target Start/End: Complemental strand, 42444660 - 42444391
Alignment:
| Q |
20 |
aactcttcttgagttagtcttgcggcaaaaccactcaacacatttctgtatgaataaatcattcgcggttgttcatcagagctcataaccgtagttggca |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42444660 |
aactcttcttgagttagtcttgcggcaaaaccactcaacacatttcggtatgaataaatcattcgcggttgttcatcagagctcataaccgtagttggca |
42444561 |
T |
 |
| Q |
120 |
tgaatgaatgatgccagctttctaaatcttcttctgattgagtgaatagcttaccctctggcttattcacatggataatgtatatttttgaagtgcttgt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42444560 |
tgaatgaatgatgccagctttctaaatcttcttctgattgagtgaatagcttaccctctggcttattcacatggataatgtatatttttgaagtgcttgt |
42444461 |
T |
 |
| Q |
220 |
ctcagtactccgagcggtagggtgcagttcacttccttgagtaaaatgaatatggaaactcaacacgaaa |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42444460 |
ctcagtactccgagcggtagggtgcagttcacttccttgagtaaaatgaatatggaaactcaacacgaaa |
42444391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University