View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9551_high_8 (Length: 219)

Name: NF9551_high_8
Description: NF9551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9551_high_8
NF9551_high_8
[»] chr7 (2 HSPs)
chr7 (14-200)||(356476-356667)
chr7 (44-201)||(10582533-10582694)


Alignment Details
Target: chr7 (Bit Score: 160; Significance: 2e-85; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 14 - 200
Target Start/End: Original strand, 356476 - 356667
Alignment:
14 tatggtggtataagttgataacactgacttggttgtgaaggagcaaaataggacaaatttgattttgtcaaatgaggagttgaatcaggaaaatagtgtc 113  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
356476 tatggtggtataagctgataacactgacttggttgtgaaggagcaaaataggacaaatttgattttgtcaaatgaggagttgaatcaggaaaatagtgtc 356575  T
114 cttagaga-----caccagggctttccagattggtgtttcaaggaggatgtctttaccagccagcaatgttgtatcaatggaggcacctatt 200  Q
    ||||||||     |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
356576 cttagagacaccccaccagggctttgcagattggtgtttcaaggaggatgtctttaccagccagcaatgttgtatcaatggaggcaactatt 356667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 44 - 201
Target Start/End: Original strand, 10582533 - 10582694
Alignment:
44 ggttgtgaaggagcaaaataggacaaatttgattttgtcaaatgaggagttgaatcaggaaaatagtgtccttagagacaccagggctttccagattggt 143  Q
    ||||| ||| |||||||  |||| ||||||  |||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||| |||||||||    
10582533 ggttgcgaaagagcaaacaaggagaaatttagttttgtcaaatgaggagttgtatcaggaaaatagtgtcattagagacaccagggctttgcagattggt 10582632  T
144 gtttcaaggaggatgtcttta----ccagccagcaatgttgtatcaatggaggcacctattt 201  Q
    |||||| ||||||||||||||    |||||||||||| ||||||||| || |||||||||||    
10582633 gtttcagggaggatgtctttaccagccagccagcaatattgtatcaacggcggcacctattt 10582694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University