View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9551_low_13 (Length: 257)
Name: NF9551_low_13
Description: NF9551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9551_low_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 244
Target Start/End: Complemental strand, 32541564 - 32541321
Alignment:
| Q |
1 |
cattacgcaactgattgagtttcaggaagagtt-tgttgttaataacaggcattacttgttagaacttcgaaccgtaatgaattagagcattttttcttg |
99 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32541564 |
cattatgcaactgattgagtttcagga-gagttgtgttgttaataacaggcattacttgttagaacttcgaaccgtaatgaattagagcattttttcttg |
32541466 |
T |
|
| Q |
100 |
agatttctaatcttctaggatacaaatttcataaaaattgtacaattagctatgttttgcactcaccaggggtctagcatcttttaccttgcaataactt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32541465 |
agatttctaatcttctaggatacaaatttcataaaaattgtacaattagctatgttttgcactcaccaggggtctagcatcttttaccttgcaataactt |
32541366 |
T |
|
| Q |
200 |
ttttcataaaaatagtcttgatgggacattgactctcctcctatg |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32541365 |
ttttcataaaaatagtcttgatgggacattgactctcctcctatg |
32541321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University