View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9551_low_21 (Length: 219)
Name: NF9551_low_21
Description: NF9551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9551_low_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 160; Significance: 2e-85; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 14 - 200
Target Start/End: Original strand, 356476 - 356667
Alignment:
| Q |
14 |
tatggtggtataagttgataacactgacttggttgtgaaggagcaaaataggacaaatttgattttgtcaaatgaggagttgaatcaggaaaatagtgtc |
113 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
356476 |
tatggtggtataagctgataacactgacttggttgtgaaggagcaaaataggacaaatttgattttgtcaaatgaggagttgaatcaggaaaatagtgtc |
356575 |
T |
 |
| Q |
114 |
cttagaga-----caccagggctttccagattggtgtttcaaggaggatgtctttaccagccagcaatgttgtatcaatggaggcacctatt |
200 |
Q |
| |
|
|||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
356576 |
cttagagacaccccaccagggctttgcagattggtgtttcaaggaggatgtctttaccagccagcaatgttgtatcaatggaggcaactatt |
356667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 44 - 201
Target Start/End: Original strand, 10582533 - 10582694
Alignment:
| Q |
44 |
ggttgtgaaggagcaaaataggacaaatttgattttgtcaaatgaggagttgaatcaggaaaatagtgtccttagagacaccagggctttccagattggt |
143 |
Q |
| |
|
||||| ||| ||||||| |||| |||||| |||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
10582533 |
ggttgcgaaagagcaaacaaggagaaatttagttttgtcaaatgaggagttgtatcaggaaaatagtgtcattagagacaccagggctttgcagattggt |
10582632 |
T |
 |
| Q |
144 |
gtttcaaggaggatgtcttta----ccagccagcaatgttgtatcaatggaggcacctattt |
201 |
Q |
| |
|
|||||| |||||||||||||| |||||||||||| ||||||||| || ||||||||||| |
|
|
| T |
10582633 |
gtttcagggaggatgtctttaccagccagccagcaatattgtatcaacggcggcacctattt |
10582694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University