View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9552_low_23 (Length: 240)
Name: NF9552_low_23
Description: NF9552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9552_low_23 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 13 - 226
Target Start/End: Complemental strand, 44990752 - 44990547
Alignment:
| Q |
13 |
cattttgtatataaggttataagaaaaaattggagactattagataaatgtcacaactggttttgatgctttttgttttcttttcgtaataaggaccaaa |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44990752 |
cattttgtatataaggttataagaaaaaattggagactattagataaatgtcacaactggttttgatgctttttgttttcttttcgtaataaggaccaaa |
44990653 |
T |
|
| Q |
113 |
tgacatagtttaagaacaatatttagggacattttctaatgtacttctgggattgttccaaaaacatatacttaaatagttttgttcataatttaaaact |
212 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| | || ||||||||||||||||||||| |
|
|
| T |
44990652 |
tgacgtagtttaagaacaatatttagggacattttctaatgtacttatgggattgttccaaaaacgt--------gtatttttgttcataatttaaaact |
44990561 |
T |
|
| Q |
213 |
taaatgcaataggt |
226 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
44990560 |
taaatgcaataggt |
44990547 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University