View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9552_low_27 (Length: 238)

Name: NF9552_low_27
Description: NF9552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9552_low_27
NF9552_low_27
[»] chr8 (1 HSPs)
chr8 (1-202)||(41852577-41852778)


Alignment Details
Target: chr8 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 202
Target Start/End: Original strand, 41852577 - 41852778
Alignment:
1 tctgatatttggactcattgctcttactattgccagtgttattgtaatttgttccattgactcagatgtgcctccaaattttggctgtggttttctatat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
41852577 tctgatatttggactcattgctcttactattgccagtgttattgtaatttgttccattgactcagatgtgcctccaaattttggctgtgattttctatat 41852676  T
101 ttgtcttaaaaatcaccgacagttttgccatcctctcgattgttttgtttgtaaataaaattctgtattttgtgtaatttatcattgattggaatgagat 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41852677 ttgtcttaaaaatcaccgacagttttgccatcctctcgattgttttgtttgtaaataaaattctgtattttgtgtaatttatcattgattggaatgagat 41852776  T
201 at 202  Q
    ||    
41852777 at 41852778  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University