View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9553_low_10 (Length: 237)
Name: NF9553_low_10
Description: NF9553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9553_low_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 14 - 216
Target Start/End: Original strand, 51378673 - 51378875
Alignment:
| Q |
14 |
ttggtgttggtatgggggatatggttgaattggaatgattggatgcggaatcaaaagaagttatctgctgtagaaattgtcaatttggtacagactatgt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51378673 |
ttggtgttggtatgggggatatggttgaattggaatgattggatgcggaatcaaaagaagttatctgctgtagaaattgtcaatttggtacagactatgt |
51378772 |
T |
 |
| Q |
114 |
gcgaagagtggaaggcagttcagaactatgcagagaatggtatggtatcagatatgatacgtattggctaaaattaataagggtaataacatattgagag |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
51378773 |
gcgaagagtggaaggcagttcagaactatgcagagaatggtatggtatcagatatgatacgtattagctaaaattaataagggtaataacatattgagag |
51378872 |
T |
 |
| Q |
214 |
agc |
216 |
Q |
| |
|
||| |
|
|
| T |
51378873 |
agc |
51378875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 96 - 153
Target Start/End: Complemental strand, 51790964 - 51790906
Alignment:
| Q |
96 |
atttggtacagactatgtgcgaagagtggaagg-cagttcagaactatgcagagaatgg |
153 |
Q |
| |
|
|||| |||||||| ||| | ||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
51790964 |
atttagtacagaccatgcgggaagagtggaagggcagttcagaactatgcagagaatgg |
51790906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University