View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9553_low_9 (Length: 239)
Name: NF9553_low_9
Description: NF9553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9553_low_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 14 - 224
Target Start/End: Complemental strand, 33455643 - 33455433
Alignment:
| Q |
14 |
attctccttcactgcatagtgctatgtaattaaagtgtgaggttggtttgcaggaagacctttgaatatagtcatgaacaaggtaaaaaatgactaccct |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33455643 |
attctccttcactgcatagtgctatgtaattaaagtgtgaggttggtttgcaggaagacctttgaatatagtcatgaacaaggtaaaaaatgactaccct |
33455544 |
T |
|
| Q |
114 |
gctgtccagttgatggcgtggaaggtatgacaatgtcattattattcttctgtttggccaatggaaaaatttgaatagttagtttttagaaggcgtagct |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
33455543 |
gctgtccagttgatggcgtggaaggtatgacaatgtcattaatattcttctgtttggccaatggaacaatttgaatagttagtttttagaaggcgtagct |
33455444 |
T |
|
| Q |
214 |
aactagttttt |
224 |
Q |
| |
|
||||||||||| |
|
|
| T |
33455443 |
aactagttttt |
33455433 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University