View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9554_high_1 (Length: 210)
Name: NF9554_high_1
Description: NF9554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9554_high_1 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 98; Significance: 2e-48; HSPs: 5)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 81 - 194
Target Start/End: Complemental strand, 46510104 - 46509991
Alignment:
| Q |
81 |
ggttcaatacaacaaccacgaagctgctgaggaagtcagcaatcacatttatgattttatcaagaagtattgatcttatcaactcaattctcaggcaact |
180 |
Q |
| |
|
|||||| ||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
46510104 |
ggttcactacaacaaccaagaagctgctgaggaagtcagtaatcacatttatgattttatcaagaagtattgatcttatcaactcaattctcaagcaact |
46510005 |
T |
 |
| Q |
181 |
cttcactatgagct |
194 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
46510004 |
cttcactatgagct |
46509991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 64 - 171
Target Start/End: Complemental strand, 46492774 - 46492667
Alignment:
| Q |
64 |
gttatagaggaaggtgtggttcaatacaacaaccacgaagctgctgaggaagtcagcaatcacatttatgattttatcaagaagtattgatcttatcaac |
163 |
Q |
| |
|
|||||| |||||||||||| ||| | ||||||||| |||||||||||||| | ||||||||||||||||||||||||||||||| |||| | ||||||| |
|
|
| T |
46492774 |
gttatacaggaaggtgtggctcacttcaacaaccaagaagctgctgaggatattagcaatcacatttatgattttatcaagaagttttgaacgtatcaac |
46492675 |
T |
 |
| Q |
164 |
tcaattct |
171 |
Q |
| |
|
|||||||| |
|
|
| T |
46492674 |
tcaattct |
46492667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 74 - 180
Target Start/End: Complemental strand, 46481503 - 46481400
Alignment:
| Q |
74 |
aaggtgtggttcaatacaacaaccacgaagctgctgaggaagtcagcaatcacatttatgattttatcaagaagtattgatcttatcaactcaattctca |
173 |
Q |
| |
|
||||||||| ||| | ||||||||| ||||||||||||||| |||| |||||||||||||||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
46481503 |
aaggtgtggctcacttcaacaaccaagaagctgctgaggaaatcagtaatcacatttatgattttatcaagaagttctgatcttat---ctcaattctca |
46481407 |
T |
 |
| Q |
174 |
ggcaact |
180 |
Q |
| |
|
|||||| |
|
|
| T |
46481406 |
agcaact |
46481400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 64 - 170
Target Start/End: Complemental strand, 46475875 - 46475769
Alignment:
| Q |
64 |
gttatagaggaaggtgtggttcaatacaacaaccacgaagctgctgaggaagtcagcaatcacatttatgattttatcaagaagtattgatcttatcaac |
163 |
Q |
| |
|
|||||| |||||||||||| ||| | |||||||| ||||||||||| || ||||||||||||||||||||||||||||||| | ||||| ||||||| |
|
|
| T |
46475875 |
gttatacaggaaggtgtggctcactttaacaaccaagaagctgctgaagatatcagcaatcacatttatgattttatcaagaaattctgatcgtatcaac |
46475776 |
T |
 |
| Q |
164 |
tcaattc |
170 |
Q |
| |
|
||||||| |
|
|
| T |
46475775 |
tcaattc |
46475769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 19 - 86
Target Start/End: Complemental strand, 46510823 - 46510758
Alignment:
| Q |
19 |
atgagataaatagagctgatggtaaatagagcatatctgaactacgttatagaggaaggtgtggttca |
86 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| | | | ||||||||||||||||||||||| |
|
|
| T |
46510823 |
atgagataaatagagttgatggtaaatagagcatatattta--aggttatagaggaaggtgtggttca |
46510758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University