View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9555_high_1 (Length: 491)

Name: NF9555_high_1
Description: NF9555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9555_high_1
NF9555_high_1
[»] chr3 (2 HSPs)
chr3 (88-188)||(275836-275936)
chr3 (13-61)||(275395-275443)
[»] chr4 (1 HSPs)
chr4 (107-141)||(46662938-46662972)


Alignment Details
Target: chr3 (Bit Score: 73; Significance: 4e-33; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 73; E-Value: 4e-33
Query Start/End: Original strand, 88 - 188
Target Start/End: Original strand, 275836 - 275936
Alignment:
88 tatcatatgacgtgtattggatttatagataactttaattaattaaataaaatacaaaatggaatcaactattaaaatattattgcacttgaaaccatat 187  Q
    |||||||||| ||||||| |||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||| || ||||    
275836 tatcatatgatgtgtattagatttacagataactttaattaattaaataaaatacaaaatggaatcaattattaaaatagtattgcacttgagactatat 275935  T
188 a 188  Q
    |    
275936 a 275936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 13 - 61
Target Start/End: Original strand, 275395 - 275443
Alignment:
13 agcagagaaaaatgtttagaactctattgatgtgcagactattatcata 61  Q
    ||||||||||||||| ||||||||||||||||||  |||||||||||||    
275395 agcagagaaaaatgtctagaactctattgatgtgtggactattatcata 275443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 107 - 141
Target Start/End: Complemental strand, 46662972 - 46662938
Alignment:
107 gatttatagataactttaattaattaaataaaata 141  Q
    ||||||| |||||||||||||||||||||||||||    
46662972 gatttatggataactttaattaattaaataaaata 46662938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University