View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9555_low_6 (Length: 262)
Name: NF9555_low_6
Description: NF9555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9555_low_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 8 - 247
Target Start/End: Original strand, 43909691 - 43909930
Alignment:
| Q |
8 |
taatgagagaattagagtggtgcaccatcaagtatcacaaaattagaaaagatggaccaagaccaactctatctttccaagttctttttgtttgaaaact |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43909691 |
taatgagagaattagagtggtgcaccatcaagtatcacaaaattagaaaagatggaccaagaccaactctatctttccaagttctttttgtttgaaaact |
43909790 |
T |
|
| Q |
108 |
tgatatttgactcgaattttttcaagttatgttatgggatcatcctttttgtcccgaatcatgttatgtaatttatacctcttaaaatgagatgagattt |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
43909791 |
tgatatttgactcgaattttttcaagttatgttatgggatcctcctttttgtcccgaatcatgttatgtaattcgtacctcttaaaatgagatgagattt |
43909890 |
T |
|
| Q |
208 |
gaactttgaattcttacatacattttaagagtttagtctc |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43909891 |
gaactttgaattcttacatacattttaagagtttagtctc |
43909930 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University