View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9555_low_7 (Length: 249)
Name: NF9555_low_7
Description: NF9555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9555_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 19 - 235
Target Start/End: Complemental strand, 43580990 - 43580774
Alignment:
| Q |
19 |
tttagggtcttgtaaaatttgggtttttcatttatagtccgtatnnnnnnntgaaatgtttgtgtacttctaaaacttttcgtatgtcttcgcatttgaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43580990 |
tttagggtcttgtaaaatttgggtttttcatttatagtccgtataaaaaaatgaaatgtttgtgtacttctaaaacttttcgtatgtcttcgcatttgaa |
43580891 |
T |
 |
| Q |
119 |
ccctttaatgtaagttcataggacctaaatctagtttagattgagttaggttttgattagggtccaaaaatagtactttaaaatatatgtaaataactgc |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43580890 |
ccctttaatgtaagttcataggacctaaatctagtttagattgagttaggttttgattagggtccaaaaatagtactttaaaatatatgtaaataactgt |
43580791 |
T |
 |
| Q |
219 |
ccattaagaatcacatc |
235 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
43580790 |
ccattaagaatcacatc |
43580774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University