View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9556_low_3 (Length: 332)
Name: NF9556_low_3
Description: NF9556
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9556_low_3 |
 | |
|
| [»] scaffold0391 (2 HSPs) |
| | |
|
Alignment Details
Target: chr8 (Bit Score: 168; Significance: 5e-90; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 168; E-Value: 5e-90
Query Start/End: Original strand, 15 - 231
Target Start/End: Complemental strand, 34116642 - 34116408
Alignment:
| Q |
15 |
cataggtatatatatttatccacacaaagaaataacgtagcaattttcgcagggaatatcacgttctctgattatgatgtttatcaactttttgcagttt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34116642 |
cataggtatatatatttatccacacaaagaaataacgtagcaattttcgcagggaatatcacgttctctgattatgatgtttatcaactttttgcagttt |
34116543 |
T |
|
| Q |
115 |
tcataataggaaaatgatgcttgttacgaaagaaaatttcgttgcactgcatacatgac------------------caaaaacgcgttgagtcttatct |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
34116542 |
tcataataggaaaatgatgcttgttacgaaagaaaatttcgttgcactgcatacatgaccatgtattctgtcaatgtcaaaaatgcgttgagtcttatct |
34116443 |
T |
|
| Q |
197 |
ttattcttttcgttttttatatatgactagtaaac |
231 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |
|
|
| T |
34116442 |
ttattcttttcgttctttatatatgactagtaaac |
34116408 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0391 (Bit Score: 32; Significance: 0.000000007; HSPs: 2)
Name: scaffold0391
Description:
Target: scaffold0391; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 111 - 166
Target Start/End: Complemental strand, 7093 - 7040
Alignment:
| Q |
111 |
gttttcataataggaaaatgatgcttgttacgaaagaaaatttcgttgcactgcat |
166 |
Q |
| |
|
||||||||||| ||||||||||| || ||||||||||||| ||||||||||||||| |
|
|
| T |
7093 |
gttttcataat-ggaaaatgatggttcttacgaaagaaaa-ttcgttgcactgcat |
7040 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0391; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 30 - 61
Target Start/End: Complemental strand, 7145 - 7114
Alignment:
| Q |
30 |
ttatccacacaaagaaataacgtagcaatttt |
61 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
7145 |
ttatccacacaaagaaataacgtagcaatttt |
7114 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University