View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9556_low_7 (Length: 238)
Name: NF9556_low_7
Description: NF9556
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9556_low_7 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 108 - 224
Target Start/End: Original strand, 28597011 - 28597127
Alignment:
| Q |
108 |
gaaaccaaaaatcacggtagtaatatacgtttcaaaatatgtaaatcaataaattattttgttaattaattctttctattcatcatcatatatcactgct |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28597011 |
gaaaccaaaaatcacggtagtaatatacgtttcaaaatatgtaaatcaataaattattttgttaattaattctttctattcatcatcatatatcactgct |
28597110 |
T |
 |
| Q |
208 |
aaatgtgtggtgtattt |
224 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
28597111 |
aaatgtgtggtgtattt |
28597127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University