View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9557_high_24 (Length: 328)
Name: NF9557_high_24
Description: NF9557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9557_high_24 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 311; Significance: 1e-175; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 311; E-Value: 1e-175
Query Start/End: Original strand, 1 - 323
Target Start/End: Original strand, 4411746 - 4412068
Alignment:
| Q |
1 |
atctgcatttcatgctgctactgagctcgatccacaaatacatgcgcactttgctgtcaaaacggtttctcaactatataaggacttgagagagaggatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
4411746 |
atctgcatttcatgctgctactgagctcgatccacaaatacacgcgcactttgctgtcaaaacggtttctcgactatataaggacttgagagagaggatt |
4411845 |
T |
|
| Q |
101 |
agcaaacatattctttccatgggatcaaattttaacagttcatggtcagaagaggataaggaattatctgttgaaacttcattcattcaaaagcaatggg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4411846 |
agcaaacatattctttccatgggatcaaattttaacagttcatggtcagaagaggataaggaattatctgttgaaacttcattcattcaaaagcaatggg |
4411945 |
T |
|
| Q |
201 |
ctcttcaacagttgaaaaggaaagatcagttatggaggccccaaaggggcttgccagaaagatctgtttccgttctacgtgattggatgtttcagaattt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4411946 |
ctcttcaacagttgaaaaggaaagatcagttatggaggccccaaaggggcttgccagaaagatctgtttccgttctacgtgattggatgtttcagaattt |
4412045 |
T |
|
| Q |
301 |
cctccatccgtaagtataatcta |
323 |
Q |
| |
|
||||||||||||||||| ||||| |
|
|
| T |
4412046 |
cctccatccgtaagtattatcta |
4412068 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University