View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9557_high_35 (Length: 263)
Name: NF9557_high_35
Description: NF9557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9557_high_35 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 254
Target Start/End: Original strand, 41983489 - 41983747
Alignment:
| Q |
1 |
tcattttgcttaccctccaatttatgtggaatgagttagaatcctcgattaaattatttttcaaattacagatatatccctaccttctctacattaatta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
41983489 |
tcattttgcttaccctccaatttatgtggaatgagttagaatcctcgattaaattatttttcaaattacaaatatatccctaccttctctacattaatta |
41983588 |
T |
|
| Q |
101 |
tgtatgttcccttgagtcttcacttccggttatgttttcctaccatacatgcactg---ccatggttcatgattataaaattcatcttcataaaaacaca |
197 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41983589 |
tgtatgttcccttgagtcttcacttccagttatgttttcgtaccatacatgcactgccaccatggttcatgattataaaattcatcttcataaaaacaca |
41983688 |
T |
|
| Q |
198 |
aacagttc--atagtgatttattattaactagcgtcatttttgtttcaatgagaataac |
254 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41983689 |
aacagttctgatagtgatttattattaactagcgtcatttttgtttcaatgagaataac |
41983747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University