View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9557_high_49 (Length: 238)
Name: NF9557_high_49
Description: NF9557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9557_high_49 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 37024788 - 37024555
Alignment:
| Q |
1 |
tcccacataccagccttctccttcaatctcatagcaaaattttcctgtcattacattagccagtaaatttaattacgattaattttgatcatataattc- |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37024788 |
tcccacataccagccttctccttcaatctcatagcaaaattttcctgtcattacattagccagtaaatttaattacgattaattttgatcatataattct |
37024689 |
T |
 |
| Q |
100 |
---------------taatagtgatacaatgtaatgtattgcaaataaataaatgaagtaataagtgaaaatgatggttataccgtgatgaaatttcgct |
184 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37024688 |
aattttttttttttttaatagtgatac-----aaggtattgcaaataaataaatgaagtaataagtgaaaatgatggttataccgtgatgaaatttcgct |
37024594 |
T |
 |
| Q |
185 |
gaataagacggtcaataatgttcaaaagaatgtctttag |
223 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
37024593 |
gaataagacggtcaataatgttcaaaaggatgtctttag |
37024555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University