View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9557_high_54 (Length: 222)
Name: NF9557_high_54
Description: NF9557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9557_high_54 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 12018147 - 12018366
Alignment:
| Q |
1 |
catctaagtatataaagagtatagtctatttcccatcagtggaagtaatattacagtttccaacttgatagaaatccgaactaatgagaagcagaaatta |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12018147 |
catctaagtataaaaagagtatagtctatttcccatcagtggaagtaatattacagtttccaacttgatagaaatccgaactaatgagaagcagaaatta |
12018246 |
T |
|
| Q |
101 |
tattacgtctgccgtctatttgctagtgtctcgtttgggttgtacacaatccttagttgtaatggttttttaatcataaaataagtttcatttactaaaa |
200 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
12018247 |
tattacgtctgctgtctatttgctagtgtctcgtttgggttgtacacaatccttagttgtaatgg--ttttaatcataaaataagtttcatttactaaaa |
12018344 |
T |
|
| Q |
201 |
cacccttatttgtcgttagtga |
222 |
Q |
| |
|
||||||||||| |||||||||| |
|
|
| T |
12018345 |
cacccttatttatcgttagtga |
12018366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 177 - 210
Target Start/End: Original strand, 40996402 - 40996435
Alignment:
| Q |
177 |
taaaataagtttcatttactaaaacacccttatt |
210 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| |
|
|
| T |
40996402 |
taaaattagtttcatttactaaaacacccttatt |
40996435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University