View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9557_low_100 (Length: 264)
Name: NF9557_low_100
Description: NF9557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9557_low_100 |
 | |
|
| [»] scaffold0290 (2 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 76; Significance: 3e-35; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 18 - 133
Target Start/End: Complemental strand, 24134129 - 24134014
Alignment:
| Q |
18 |
ctttgagcacatgtgctggtatggctgctttcgtgttagggaaacaactttgtaatatcccattcatcagttattggagatttttcagtcgaacgtttcc |
117 |
Q |
| |
|
||||||||||||||| | ||| |||||||||| || |||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
24134129 |
ctttgagcacatgtgttcgtaaggctgctttcatgctagggaaacaactttgtaatataccacccatcagttattggagatttttcagtcgaacgtttcc |
24134030 |
T |
|
| Q |
118 |
aaaggcgaatgtaagt |
133 |
Q |
| |
|
|| |||||||| |||| |
|
|
| T |
24134029 |
aagggcgaatgcaagt |
24134014 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 19 - 67
Target Start/End: Complemental strand, 24134362 - 24134314
Alignment:
| Q |
19 |
tttgagcacatgtgctggtatggctgctttcgtgttagggaaacaactt |
67 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
24134362 |
tttgagcacatgtgctggtatggctgctttggtgttaaggaaacaactt |
24134314 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 23 - 67
Target Start/End: Complemental strand, 24136672 - 24136628
Alignment:
| Q |
23 |
agcacatgtgctggtatggctgctttcgtgttagggaaacaactt |
67 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
24136672 |
agcacatgtgctggtatggctgctttggtgttagggaaacgactt |
24136628 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 18 - 64
Target Start/End: Original strand, 45149226 - 45149272
Alignment:
| Q |
18 |
ctttgagcacatgtgctggtatggctgctttcgtgttagggaaacaa |
64 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
45149226 |
ctttgagcacatgtgctggtatggctgctttggtgttagggaaacaa |
45149272 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0290 (Bit Score: 32; Significance: 0.000000006; HSPs: 2)
Name: scaffold0290
Description:
Target: scaffold0290; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 196 - 235
Target Start/End: Original strand, 4256 - 4295
Alignment:
| Q |
196 |
agtgtcagaataagaacgattaagacgaagggtattttgg |
235 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
4256 |
agtgtcaaaataagaacggttaagacgaagggtattttgg |
4295 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0290; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 198 - 234
Target Start/End: Original strand, 1521 - 1557
Alignment:
| Q |
198 |
tgtcagaataagaacgattaagacgaagggtattttg |
234 |
Q |
| |
|
||||| || |||||||||||||||||||||||||||| |
|
|
| T |
1521 |
tgtcaaaagaagaacgattaagacgaagggtattttg |
1557 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University