View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9557_low_109 (Length: 250)
Name: NF9557_low_109
Description: NF9557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9557_low_109 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 98 - 240
Target Start/End: Complemental strand, 42251687 - 42251545
Alignment:
| Q |
98 |
caaagccatatccttttgattttccagtggttctgtcagtgatgacaacagcttctaaaatatcaccaaactgatcaaagtaacgtttgagtgtgtctct |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42251687 |
caaagccatatccttttgattttccagtggttctgtcagtgatgacaacagcttctaaaatatcaccaaactgatcaaagtaacgtttgagtgtgtctct |
42251588 |
T |
 |
| Q |
198 |
tttggtctcccaagctaacccaccaacaaaaatcttagtataa |
240 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
42251587 |
tttggtctcccaagctaaccctccaacaaaaatcttcgtataa |
42251545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 122 - 212
Target Start/End: Original strand, 12773258 - 12773347
Alignment:
| Q |
122 |
cagtggttctgtcagtgatgacaacagcttctaaaatatcaccaaactgatcaaagtaacgtttgagtgtgtctcttttggtctcccaagc |
212 |
Q |
| |
|
||||||||||||||||||| |||||||| ||||| ||||||||||||| || ||| ||| ||| | ||||||||| ||||| |||||||| |
|
|
| T |
12773258 |
cagtggttctgtcagtgataacaacagcctctaagatatcaccaaactaat-aaaacaacatttcattgtgtctctcttggtttcccaagc |
12773347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 98 - 176
Target Start/End: Complemental strand, 12141692 - 12141614
Alignment:
| Q |
98 |
caaagccatatccttttgattttccagtggttctgtcagtgatgacaacagcttctaaaatatcaccaaactgatcaaa |
176 |
Q |
| |
|
|||| ||||| ||||| ||| ||||||||| | |||||||||| ||||||||||| || || |||||||| || ||||| |
|
|
| T |
12141692 |
caaatccatagcctttggatcttccagtggctttgtcagtgataacaacagcttccaagatctcaccaaattgctcaaa |
12141614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University