View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9557_low_112 (Length: 248)
Name: NF9557_low_112
Description: NF9557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9557_low_112 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 30731795 - 30732022
Alignment:
| Q |
1 |
agttttgttgggatggatgaaaggaaggtgtgtatgtcagtgaaatcttgcctcctatgggttttgatttgttgtactcannnnnnnaattattgatgtt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
30731795 |
agttttgttgggatggatgaaaggaaggtgtgtatgtcactgaaatcttgcctcctatgggttttgatttgttgtactc-tttttttaattattgatgtt |
30731893 |
T |
 |
| Q |
101 |
ttccatggatatgtaatcttctttattttgacgtattaattggaagg-nnnnnnnnccgaagtgtaaatattttcatcaattctagttgtatatgcatgc |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||| || ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
30731894 |
ttccatggatatgtaatcttctttattttgacatattaattggaaggaaaaaaaaaccaaagtgtaaatattttcatcaattctagttgtat----atgc |
30731989 |
T |
 |
| Q |
200 |
atatggtgagtgtaaaatgttacaccatgtttt |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
30731990 |
atatggtgagtgtaaaatgttacaccatgtttt |
30732022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University