View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9557_low_129 (Length: 240)

Name: NF9557_low_129
Description: NF9557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9557_low_129
NF9557_low_129
[»] chr4 (1 HSPs)
chr4 (16-223)||(54271444-54271651)


Alignment Details
Target: chr4 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 16 - 223
Target Start/End: Complemental strand, 54271651 - 54271444
Alignment:
16 gagaggatttgatagatgagattggtgaaggggatgtccatgaagattggaattcgaaggaaagtggatttggtttgaaagagtggatttcgatggaaga 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54271651 gagaggatttgatagatgagattggtgaaggggatgtccatgaagattggaattcgaaggaaagtggatttggtttgaaagagtggatttcgatggaaga 54271552  T
116 gaggttggaatcgaaatcggaagtagcgagaacggcgaagcggttgaatgcggatagaactggaagccaacgaacggcgtcgatgtatttgtattgtggg 215  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54271551 gaggttggaatcgaaatcggaagtagcgagaacggcgaagcggttgaatgcggatagaactggaagccaacgaacggcgtcgatgtatttgtattgtggg 54271452  T
216 aatctgtg 223  Q
    ||||||||    
54271451 aatctgtg 54271444  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University