View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9557_low_135 (Length: 238)
Name: NF9557_low_135
Description: NF9557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9557_low_135 |
 | |
|
| [»] scaffold0082 (1 HSPs) |
| | |
|
Alignment Details
Target: chr2 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 27 - 229
Target Start/End: Complemental strand, 17605145 - 17604940
Alignment:
| Q |
27 |
agctatgacttcttccttctaggcttacttgtcaagtacaatagcaatgaattatgtaccagaaagctttatttaaaatgtt---tccacttcgttccat |
123 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||| ||| ||||||||||||| |||||||||||||| ||||| ||| || ||||||| |
|
|
| T |
17605145 |
agctacgacttcttccttctaggcttacttgtcaagtacaataacaacgaattatgtaccaaaaagctttatttaacatgttgtttcctctctgttccat |
17605046 |
T |
|
| Q |
124 |
ctttctaaatcagttagatcagtgccctttgtttatctgaatgctttgcactgcccttctaaacagtttctttgatcttgctcggttttccttttccctt |
223 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
17605045 |
ctttctaaataagttagatcagtgccctttgtttatctgaatgctttgcactgcccttctaaacagtttctttgatcttgctcagttttccttttccctt |
17604946 |
T |
|
| Q |
224 |
tgcttc |
229 |
Q |
| |
|
|||||| |
|
|
| T |
17604945 |
tgcttc |
17604940 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0082 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0082
Description:
Target: scaffold0082; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 188 - 229
Target Start/End: Complemental strand, 15245 - 15204
Alignment:
| Q |
188 |
agtttctttgatcttgctcggttttccttttccctttgcttc |
229 |
Q |
| |
|
||||||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
15245 |
agtttctttgatcttactcggtcttccttttccctttgcttc |
15204 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University