View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9557_low_144 (Length: 227)
Name: NF9557_low_144
Description: NF9557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9557_low_144 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 28119228 - 28119002
Alignment:
| Q |
1 |
atcatctctcttcttgaattgatgatgaattacatcccttacatctcaatcaatctacttacaacatattttaattaatattacggctacattacatata |
100 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28119228 |
atcatctctcttcttgaattgatgatggattacatcccttacatctcaatcaatctacttacaacatattttaattaatattacggctacattacatata |
28119129 |
T |
 |
| Q |
101 |
tat-----catcactcatcaacacagttagctataaaagttcaataatttcatcatcacaaaaaatactgattaatgtctcatcaacaaagtaatttgtt |
195 |
Q |
| |
|
||| ||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28119128 |
tatattatcatcactcatcgacacagttagctataaaagttcaataatttcaacatcacaaaaaatactgattaatgtctcatcaacaaagtaatttgtt |
28119029 |
T |
 |
| Q |
196 |
agagacacaaacacatcctttgcttct |
222 |
Q |
| |
|
|||||||||||||||||||||| |||| |
|
|
| T |
28119028 |
agagacacaaacacatcctttgattct |
28119002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University