View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9557_low_55 (Length: 371)
Name: NF9557_low_55
Description: NF9557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9557_low_55 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 256; Significance: 1e-142; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 41 - 353
Target Start/End: Original strand, 45756907 - 45757215
Alignment:
| Q |
41 |
aatattcttttcgatggtacttttgtcaataatgtttggttcttctcacatgaagatttcaccttattagatattcgcattttgcgatcattattaactt |
140 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
45756907 |
aatattcttttcgatggtacttttgtcaataatgtttggttcttctcacattaagatttcaccttattagatattcgcattttgccaccattattaactt |
45757006 |
T |
 |
| Q |
141 |
attattactcttattcttttttcttctagatctttcgtatctactacaagtaacgtgctttttnnnnnnnntggtaacataccactaattagagttccaa |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
45757007 |
attattactcttattcttttttcttctagatctttcgtatctactacaagtaacgtgctttttaaaaaaaatggtaacataccactaattagagttccaa |
45757106 |
T |
 |
| Q |
241 |
tggatttttatacggcaaattgttgtattgaccaccttgataagttgttgacagtagattattactactagtgaatatagaacatcttaattaacatgca |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
45757107 |
tggatttttatacggcaaattgttgtattgaccaccttgataagttgttgacagtagattactactactagtgaatatagaacatc----ttaacatgca |
45757202 |
T |
 |
| Q |
341 |
taatataatatgt |
353 |
Q |
| |
|
||||||||||||| |
|
|
| T |
45757203 |
taatataatatgt |
45757215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 45756825 - 45756869
Alignment:
| Q |
1 |
ggtactaacaaacttaaattttgggaaaacatttgctatgaatat |
45 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45756825 |
ggtactaacaaacttaaattttgggaaaacatttgctatgaatat |
45756869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University