View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9557_low_76 (Length: 320)
Name: NF9557_low_76
Description: NF9557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9557_low_76 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 287; Significance: 1e-161; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 14 - 304
Target Start/End: Original strand, 48478993 - 48479283
Alignment:
| Q |
14 |
agaccaaagactctccagttctgcttgacgtcaccggaatgatgtgcggcgggtgcgtctcccgagtcaaaaccattctctcctccgacgatcgagttga |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48478993 |
agaccaaagactctccagttctgcttgacgtcaccggaatgatgtgcggcgggtgcgtctcccgagtcaaaaccattctctcctccgacgatcgagttga |
48479092 |
T |
 |
| Q |
114 |
ctctgtagttgtcaacatgttgactgaaaccgccgctgttaagcttaaaaagctcgaagaggaatctaccagcgttgcggatggacttgctcggagattg |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48479093 |
ctctgtagttgtcaacatgttgactgaaaccgctgctgttaagcttaaaaagctcgaagaggaatctaccagcgttgcggatggacttgctcggagattg |
48479192 |
T |
 |
| Q |
214 |
acgggatgcgggtttccgacgaagaggagagaatcgggtttaggagtttcggagaatgtgaggaagtggaaggagttggtgaagaagaaag |
304 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48479193 |
acgggatgcgggtttccgacgaagaggagagaatcgggtttaggagtttcggagaatgtgaggaagtggaaggagttggtgaagaagaaag |
48479283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University