View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9557_low_79 (Length: 305)
Name: NF9557_low_79
Description: NF9557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9557_low_79 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 22 - 295
Target Start/End: Original strand, 32938765 - 32939038
Alignment:
| Q |
22 |
gactgcacactttcttctagattggagcaatgcaggaacatttacaatttatgcaattttttctgccatcaacgttgcttttgctctactttgggttcca |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32938765 |
gactgcacactttcttctagattggagcaatgcaggaacatttacaatttatgcaattttttctgccatcaacgttgcttttgctctactttgggttcct |
32938864 |
T |
 |
| Q |
122 |
gagaccaaggacagaacattggaagaaattcaggcatcgtttattagataattttcatgattaattattttattctatatataatttatgtgtgaccatt |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32938865 |
gagaccaaggacagaacattggaagaaattcaggcatcgtttattagataattttcatgattaattattttattctatatataatttatgtgtgaccatt |
32938964 |
T |
 |
| Q |
222 |
aagttttggcacacacaaatccatttgtgttacattggtcttgtataggaaaatctggaaaagaatcctctctg |
295 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32938965 |
aagttttggtacacacaaatccatttgtgttacattggtcttgtataggaaaatctggaaaagaatcctctctg |
32939038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University