View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9557_low_8 (Length: 587)
Name: NF9557_low_8
Description: NF9557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9557_low_8 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 331; Significance: 0; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 331; E-Value: 0
Query Start/End: Original strand, 183 - 578
Target Start/End: Complemental strand, 2332085 - 2331691
Alignment:
| Q |
183 |
ttgcttatggcttttgcacatataaaacgttttgatccttgtctccccacaatcgtttctatttgaannnnnnnc-atatattgtattactagttt-acc |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||| |
|
|
| T |
2332085 |
ttgcttatggcttttgcacatataaaacgttttgatccttgtctccccacaatcgtttctatttgaatttttttatatatattgtattactagttttacc |
2331986 |
T |
 |
| Q |
281 |
ttctctttaggttgtttggtagaggttttctcttgcaaaaatacttatgtgcagttcttcgaatagctagtgttcatccggttcataactttagttacaa |
380 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2331985 |
ttctctttaggttgtttggtagaggttttctcttgcaaaaatacttatgtgcagttcttcgaatagctagtgttcatccggttcataactttagttacaa |
2331886 |
T |
 |
| Q |
381 |
aataaattattaaaactgcccaaccgccattaatccaaatcatttttaaacgacaatgtttaggtacattcatgtgaagaactgagcgaatagtgtgcag |
480 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||| || |
|
|
| T |
2331885 |
aataaattattaaaactgcccaaccgccattaatccaaatcatttttaaacgacaatgtttaggtgcattcatgtgaaaaactgagcgaatagtgtgtag |
2331786 |
T |
 |
| Q |
481 |
ggaacgatacctaagtattctcctttcttgtgttggttttcccttttaactgtttttcaccattattggtggtgatcattgttgtttcttagtattat |
578 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
2331785 |
ggaacgatacctaagtattctcctttcttgtgttggttttcccttttaactgtttttcacc---attggtggtgatcattgttgtttcttagtattat |
2331691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 18 - 100
Target Start/End: Complemental strand, 2332247 - 2332167
Alignment:
| Q |
18 |
cttgcattcgtgcaccatatgttttccacattcaaaccagaaattttatttcgtcgtcttctgatgatggcctgcgtatataa |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
2332247 |
cttgcattcgtgcaccat--gttttccacattcaaaccagaaattttatttcgccgtcttctgatgatggcctgcgtgtataa |
2332167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University