View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9557_low_81 (Length: 303)
Name: NF9557_low_81
Description: NF9557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9557_low_81 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 276; Significance: 1e-154; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 6 - 285
Target Start/End: Original strand, 51027496 - 51027775
Alignment:
| Q |
6 |
gtttggtggtggttattggttagttagggttatgcaaaattggatttgtgttcttgtaattgcagaaagcttagcatattgaaattggatttgtttgtgt |
105 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51027496 |
gtttgttggtggttattggttagttagggttatgcaaaattggatttgtgttcttgtaattgcagaaagcttagcatattgaaattggatttgtttgtgt |
51027595 |
T |
|
| Q |
106 |
ttttaacgcaggcatcaagggcgaggctgttcaaggagtacaaagaagtgcaacgagagaagacagctgatcctgatattcaactcgtttgtgatgattc |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51027596 |
ttttaacgcaggcatcaagggcgaggctgttcaaggagtacaaagaagtgcaacgagagaagacagctgatcctgatattcaactcgtttgtgatgattc |
51027695 |
T |
|
| Q |
206 |
caacatttttaaatggacagctctaatcaaggtatgctagcgaatgctctcgacgattagaatatggtttatgatagaac |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51027696 |
caacatttttaaatggacagctctaatcaaggtatgctagcgaatgctctcgacgattagaatatggtttatgatagaac |
51027775 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University