View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9557_low_87 (Length: 289)
Name: NF9557_low_87
Description: NF9557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9557_low_87 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 18 - 280
Target Start/End: Original strand, 50421625 - 50421892
Alignment:
| Q |
18 |
taaacattgttctctaaaa-agcacacaggatctaaacaaccaaaactacttttaaccattatgctaacatgagttaggtttagtttaaaaccattttcc |
116 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50421625 |
taaacattgttctctaaaaaagcacacaggatctaaacaaccaaaactacttttaaccattatgctaacatgagttaggtttagtttaaaaccattttcc |
50421724 |
T |
|
| Q |
117 |
gataatctaacaccgggaagtgagaagctttcgcttcccaattttcatccaacaaaatatttgttgttttcacatcgcgatgaatgttgatggtgtattt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50421725 |
gataatctaacaccgggaagtgagaagctttcgcttcccaattttcatccaacaaaatatttgttgttttcacatcgcgatgaatgttgatggtgtattt |
50421824 |
T |
|
| Q |
217 |
tgcaccg----gtgtgaaggtaatcaagtctctttgcagcaccaatgcaaatttccaacctttgcttc |
280 |
Q |
| |
|
||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
50421825 |
tgcaccggtacgtgtgaaggtaatcaagtctccttgcagcaccaatgcaaatttccaacctttgcttc |
50421892 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 176 - 280
Target Start/End: Original strand, 35904623 - 35904724
Alignment:
| Q |
176 |
tttgttgttttcacatcgcgatgaatgttgatggtgtattttgcaccggtgtgaaggtaatcaagtctctttgcagcaccaatgcaaatttccaaccttt |
275 |
Q |
| |
|
||||||||||||||||| | |||||| || ||||| |||||||| ||||||||||||| ||| | ||||||||||||||||||| |||||||||| |
|
|
| T |
35904623 |
tttgttgttttcacatctctatgaatt---atagtgtactttgcacctgtgtgaaggtaatgaagacctcttgcagcaccaatgcaaatctccaaccttt |
35904719 |
T |
|
| Q |
276 |
gcttc |
280 |
Q |
| |
|
||||| |
|
|
| T |
35904720 |
gcttc |
35904724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University