View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9559_high_1 (Length: 284)
Name: NF9559_high_1
Description: NF9559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9559_high_1 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 106; Significance: 4e-53; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 162 - 271
Target Start/End: Complemental strand, 33152989 - 33152880
Alignment:
| Q |
162 |
ttgagctctttggagaaccaatctcttggtgctcaaagaaacaaacaattattgtcctctcatcatgtgaagttgagtatattgcggcttgttaggcagc |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
33152989 |
ttgagctctttggagaaccaatctcttggtgctcaaagaaacaaacaattattgtcctctcatcatgtgaagttgagtatattgcggcttgttacgcagc |
33152890 |
T |
 |
| Q |
262 |
atgccaagct |
271 |
Q |
| |
|
|||||||||| |
|
|
| T |
33152889 |
atgccaagct |
33152880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 77; E-Value: 9e-36
Query Start/End: Original strand, 14 - 122
Target Start/End: Complemental strand, 33153125 - 33153017
Alignment:
| Q |
14 |
agacaagcgaaaaactaaatgttcattgtgcttcaatgaacaatattgttcaaaccagtgttgtcaataggaagnnnnnnnnctagcttgcaatgcacta |
113 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
33153125 |
agacaagcgaaaatctaaatgttcattgtgcttcaatgaacaatattgttcaaaccagtgttgtcaataggaagaaaaaaaactaggttgcaatgcacta |
33153026 |
T |
 |
| Q |
114 |
aaagtaaaa |
122 |
Q |
| |
|
||||||||| |
|
|
| T |
33153025 |
aaagtaaaa |
33153017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University