View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9559_low_6 (Length: 253)
Name: NF9559_low_6
Description: NF9559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9559_low_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 10 - 237
Target Start/End: Complemental strand, 4410541 - 4410314
Alignment:
| Q |
10 |
attattctcttgagctttcaaaaacttgttaacatagctattattatcaccaaaagttgcacacaaagggtttgagtttgaagtatcatgccaattattg |
109 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4410541 |
attactctcttgagctttcaaaaacttgttaacatagctattattatcaccaaaagttgcacacaaagggtttgagtttgaagtatcatgccaattattg |
4410442 |
T |
|
| Q |
110 |
aatatgtatggaactattgcttctaaattttcttgaagaccgattctagccggaaccaaaaagtcattgttattaacaatgagatttgagggattttcca |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4410441 |
aatatgtatggaactattgcttctaaattttcttgaagaccgattctagccggaaccgaaaagtcattgttattaacaatgagatttgagggattttcca |
4410342 |
T |
|
| Q |
210 |
caatagtccttccttgttgtgatgtaac |
237 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
4410341 |
caatagtccttccttgttgtgatgtaac |
4410314 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University