View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9561_high_10 (Length: 228)
Name: NF9561_high_10
Description: NF9561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9561_high_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 16 - 216
Target Start/End: Original strand, 7135704 - 7135907
Alignment:
| Q |
16 |
aaaacaatgtcgagtaaataagtattttaatttttgaaaaggtatgttcatttcatttagcctttagccgnnnnnnntaatttatttagtcttttaaatg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
7135704 |
aaaacaatgtcgagtaaataagtattttaatttttgaaaaggtatgttcatttcatttagcctttagccgaaaaaaataattcatttagtcttttaaatg |
7135803 |
T |
|
| Q |
116 |
cgcaaaatactagtagcaa---attgattccttcaaatttaagaaagtcagttcattcaaactttatcttactcttaaagtagcatgaaactattcagaa |
212 |
Q |
| |
|
|||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
7135804 |
cgcaaaatactagtagtaattaattgattccttcaaatttaagaaagtcagttcattcaaactttatcttactcttaaagtagcatgaaactattcaaaa |
7135903 |
T |
|
| Q |
213 |
taat |
216 |
Q |
| |
|
|||| |
|
|
| T |
7135904 |
taat |
7135907 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University