View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9561_low_26 (Length: 228)

Name: NF9561_low_26
Description: NF9561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9561_low_26
NF9561_low_26
[»] chr5 (1 HSPs)
chr5 (16-216)||(7135704-7135907)


Alignment Details
Target: chr5 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 16 - 216
Target Start/End: Original strand, 7135704 - 7135907
Alignment:
16 aaaacaatgtcgagtaaataagtattttaatttttgaaaaggtatgttcatttcatttagcctttagccgnnnnnnntaatttatttagtcttttaaatg 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||| |||||||||||||||||    
7135704 aaaacaatgtcgagtaaataagtattttaatttttgaaaaggtatgttcatttcatttagcctttagccgaaaaaaataattcatttagtcttttaaatg 7135803  T
116 cgcaaaatactagtagcaa---attgattccttcaaatttaagaaagtcagttcattcaaactttatcttactcttaaagtagcatgaaactattcagaa 212  Q
    |||||||||||||||| ||   ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
7135804 cgcaaaatactagtagtaattaattgattccttcaaatttaagaaagtcagttcattcaaactttatcttactcttaaagtagcatgaaactattcaaaa 7135903  T
213 taat 216  Q
    ||||    
7135904 taat 7135907  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University