View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9563_high_14 (Length: 285)
Name: NF9563_high_14
Description: NF9563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9563_high_14 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 19 - 272
Target Start/End: Original strand, 29761013 - 29761266
Alignment:
| Q |
19 |
gttatgccatgtttgggaaagtattgaggtcctcaaaggtgattttatatggaacaaaggtgattttgttttggttatagtttgttatgattgatttgtt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29761013 |
gttatgccatgtttgggaaagtattgaggtcctcaaaggtgattttatatggaacaaaggtgattttgttttggttatagtttgttatgattgatttgtt |
29761112 |
T |
|
| Q |
119 |
cttgtaaggactagggaaaatgcctgtaaacatggatgtagacgtggacactggataaaactatcgctcatagactgataatagtttaagaaaatggtag |
218 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29761113 |
cttgtaaggactagggaaaaggcctgtaaatatggatgtagacgtggacaccggataaaactatcgctcatagactgataatagtttaagaaaatggtag |
29761212 |
T |
|
| Q |
219 |
taattgagtgtctgacatcaataaatgtcggatactggacaccgatttcaatct |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29761213 |
taattgagtgtctgacatcaataaatgtcggatactggacaccgatttcaatct |
29761266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University