View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9563_high_21 (Length: 229)
Name: NF9563_high_21
Description: NF9563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9563_high_21 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 212
Target Start/End: Original strand, 51967826 - 51968037
Alignment:
| Q |
1 |
caagggtagcatggttgcgtacatgtgctgctatgcaagggaaatgaaaagcatgtgcacattctgctgtgtatattgccttaccctgccctgttttcac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
51967826 |
caagggtagcatggttgcgtacatgtgctgctatgcaagggaaatgaaaagcatgtgcacattctgctgtgtatattgccttcccctgccccgttttcac |
51967925 |
T |
|
| Q |
101 |
gctattcaaacagattccacagctactctgaatcaaacaataatatcaaaataaataaggcagatcagtatcattatttggatctcaataacataggaaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
51967926 |
gctattcaaacagattccacagctactctgaatcaaacaataatatcaaaataaataaggcagatcagtatcattatttggatctcaataaaataggaaa |
51968025 |
T |
|
| Q |
201 |
aaaggaattcat |
212 |
Q |
| |
|
|||||||||||| |
|
|
| T |
51968026 |
aaaggaattcat |
51968037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University