View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9563_low_23 (Length: 331)
Name: NF9563_low_23
Description: NF9563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9563_low_23 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 16 - 252
Target Start/End: Complemental strand, 48416744 - 48416508
Alignment:
| Q |
16 |
aggcaacatttaactcgatcgtgattcggtggtgtaataaagcaggcaattttcatattattagatctcgatcattaattaaaattcgaacggttcaaat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
48416744 |
aggcaacatttaactcgatcgtgattcggtggtgtaataaagcacgcaattttcatattattagatctcgatcattaattaaaattcgaccggttcaaat |
48416645 |
T |
|
| Q |
116 |
taatatagttataaaatctttctaaacggtctcaatcacatgttttagattggatggtcttgatttgttacgtgttacaacatctcatctatctatgatg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| || |
|
|
| T |
48416644 |
taatatagttataaaatctttctaaacgatctcaatcacatgttttagattggatggtcttgatttgttacgtgttacaacatcccatctatctatggtg |
48416545 |
T |
|
| Q |
216 |
ttaataattatgactttactttatgggattcaacacc |
252 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| |
|
|
| T |
48416544 |
ttaataattatggctttactttatgggattcaacacc |
48416508 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 80 - 186
Target Start/End: Complemental strand, 35003536 - 35003430
Alignment:
| Q |
80 |
atctcgatcattaattaaaattcgaacggttcaaattaatatagttataaaatctttctaaacggtctcaatcacatgttttagattggatggtcttgat |
179 |
Q |
| |
|
||||||| ||||||||||| | ||| ||||||||| ||| | |||||||||| ||| || | |||||| |||||||||||||| ||||| || |||| |
|
|
| T |
35003536 |
atctcgaccattaattaaagattgaatggttcaaatcaatgcaattataaaatcattcaaaccaatctcaaccacatgttttagatcggatgatcctgat |
35003437 |
T |
|
| Q |
180 |
ttgttac |
186 |
Q |
| |
|
||||||| |
|
|
| T |
35003436 |
ttgttac |
35003430 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University