View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9563_low_36 (Length: 273)
Name: NF9563_low_36
Description: NF9563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9563_low_36 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 123; Significance: 3e-63; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 130 - 252
Target Start/End: Complemental strand, 44583709 - 44583587
Alignment:
| Q |
130 |
tgtagcatttgattatagaagaccatgcgagaggtggtggaggagaaggaagggagttgaagaggtggagggaatgttgtaagaggttgagatttgagta |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44583709 |
tgtagcatttgattatagaagaccatgcgagaggtggtggaggagaaggaagggagttgaagaggtggagggaatgttgtaagaggttgagatttgagta |
44583610 |
T |
 |
| Q |
230 |
gagtgagagtacgaggatgttgt |
252 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
44583609 |
gagtgagagtacgaggatgttgt |
44583587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 9 - 62
Target Start/End: Complemental strand, 44583830 - 44583777
Alignment:
| Q |
9 |
tggtgtttcaaaagagtggaagctttgagaagagaagggaaaacatggcgattg |
62 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44583830 |
tggtgtttcaaaagagtggaagctttgagaagagaagggaaaacatggcgattg |
44583777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University