View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9564_high_17 (Length: 219)
Name: NF9564_high_17
Description: NF9564
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9564_high_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 9 - 203
Target Start/End: Complemental strand, 5207695 - 5207515
Alignment:
| Q |
9 |
tttggtgttgacattttgctcaaaatcaaattatgcagaaatttcctagcaacgcatttaattttattttcaattacgaatagattcatgcactcttgat |
108 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5207695 |
tttggtgttgacattttgctcaaaatcatattatgcag--------------cgcatttaattttattttcaattacgaatagattcatgcactcttgat |
5207610 |
T |
 |
| Q |
109 |
tcagaggaaatgtagtgtttcttgtgaatagattcattagttgaatgaaccagtcatgtgcagagttcaatctttgcttctaacaagttccctct |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5207609 |
tcagaggaaatgtagtgtttcttgtgaatagattcattagttgaatgaaccagtcatgtgcagagttcaatctttgcttctaacaagttccctct |
5207515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University