View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9564_low_27 (Length: 244)

Name: NF9564_low_27
Description: NF9564
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9564_low_27
NF9564_low_27
[»] chr1 (1 HSPs)
chr1 (1-227)||(4002553-4002779)


Alignment Details
Target: chr1 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 4002779 - 4002553
Alignment:
1 ttttggtaatgtgaatttgaaggttaaacctgtgataacgaataatgtggcacctaggtttggttttggttttggatcgaagaggaaaacttgtgaacgt 100  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4002779 ttttggtaatgtgaatttgaaggttaagcctgtgataacgaataatgtggcacctaggtttggttttggttttggatcgaagaggaaaacttgtgaacgt 4002680  T
101 gtgagtttggggaagatttcaagttttgttgttagattgttttggagagaagccaaaaggattcaatcgtttcctgttctttctcttgctgctgcattgg 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4002679 gtgagtttggggaagatttcaagttttgttgttagattgttttggagagaagccaaaaggattcaatcgtttcctgttctttctcttgctgctgcattgg 4002580  T
201 tgccgccaattcaaaatttgtatgtat 227  Q
    |||||||||||||||||||||||||||    
4002579 tgccgccaattcaaaatttgtatgtat 4002553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University