View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9564_low_38 (Length: 217)
Name: NF9564_low_38
Description: NF9564
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9564_low_38 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 15 - 199
Target Start/End: Complemental strand, 46534710 - 46534526
Alignment:
| Q |
15 |
gtatcatagagagaaggacattatatctcaccaacgttggagactcgcgcgctatacttggttctaagataggtattggtccatttaaaagactgtgtgt |
114 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
46534710 |
gtatcatagagagaaggacattatatctcgccaacgttggagactcgcgcgctatacttggttctaagatgggtattggtccatttaaaagactgtgtgt |
46534611 |
T |
|
| Q |
115 |
taagcaaatggctagagatcacagttgtaataatcagaatattcgagatgaactcactgtattgcatgatgataattggatttgc |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
46534610 |
taagcaaatggctagagatcacagttgtaataatcagaatattcgagatgaactcgctgtattgcatgatgataattggatttgc |
46534526 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 50 - 142
Target Start/End: Original strand, 37041269 - 37041361
Alignment:
| Q |
50 |
gttggagactcgcgcgctatacttggttctaagataggtattggtccatttaaaagactgtgtgttaagcaaatggctagagatcacagttgt |
142 |
Q |
| |
|
||||||||||| |||||||| |||| |||| | | ||| ||||||||||||||| || ||||||||||||||| |||||||||| |||| |
|
|
| T |
37041269 |
gttggagactcacgcgctattcttgtttctcataagggtgatggtccatttaaaaggttgcatgttaagcaaatggccagagatcacaattgt |
37041361 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University