View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9564_low_41 (Length: 206)
Name: NF9564_low_41
Description: NF9564
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9564_low_41 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 92; Significance: 7e-45; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 14 - 196
Target Start/End: Original strand, 15850081 - 15850263
Alignment:
| Q |
14 |
ttattctctcccacttcattagcagaaatttccagctccacgactttatctctcagtcttttctggtaaggagnnnnnnnnntcagttttacaaagctaa |
113 |
Q |
| |
|
||||| |||||||||| |||||||||| ||||| |||||| | || |||| ||||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
15850081 |
ttattttctcccacttgattagcagaactttccgactccacaatttcatctatcagtctattctggtaaggagaaaaaaaaatcagttttacaaagctaa |
15850180 |
T |
 |
| Q |
114 |
atacaaaaagcataaacaatttttgcaagtataacatcggctaaagttagtaacaaatattcatcgcagatgtttggagtgat |
196 |
Q |
| |
|
||| ||||||||||||||||||||||||||||| ||| |||||||||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
15850181 |
gtaccaaaagcataaacaatttttgcaagtataatatcagctaaagttagtaacaaacattcatcgcagatatttggagtgat |
15850263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University