View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9565_high_1 (Length: 434)
Name: NF9565_high_1
Description: NF9565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9565_high_1 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 57; Significance: 1e-23; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 83 - 147
Target Start/End: Complemental strand, 2943454 - 2943390
Alignment:
| Q |
83 |
tcatttcgcttaaataaatatgtagataaataaattgatcattatatatgggtggttacgtagta |
147 |
Q |
| |
|
||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2943454 |
tcatttctcttgaataaatatgtagataaataaattgatcattatatatgggtggttacgtagta |
2943390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University