View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9565_high_2 (Length: 338)
Name: NF9565_high_2
Description: NF9565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9565_high_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 204; Significance: 1e-111; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 99 - 322
Target Start/End: Complemental strand, 4665602 - 4665379
Alignment:
| Q |
99 |
cttatgcatactcaattgtgtgtagcatatataaaatgaagaatatgatatcattttaaacgagttttttcgatgatatttgattttattagaattagat |
198 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
4665602 |
cttatgcacactcaattgtgtgtagcatatataaaatgaagaatatgatatcattttaaacgagttttttcgatgataattgattttattagaattagat |
4665503 |
T |
 |
| Q |
199 |
attagtcttggttgattgtgttcagtctaagactgagaagaccttagattgagtttgtttcgtagtttcaaaatttattctcttggattacattctctag |
298 |
Q |
| |
|
|||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4665502 |
attagtcttggttgattgtgtttggtcgaagactgagaagaccttagattgagtttgtttcgtagtttcaaaatttattctcttggattacattctctag |
4665403 |
T |
 |
| Q |
299 |
gaatattattcccaccaaagtgtt |
322 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
4665402 |
gaatattattcccaccaaagtgtt |
4665379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 7 - 37
Target Start/End: Complemental strand, 4665694 - 4665664
Alignment:
| Q |
7 |
taaataattcttttgctcctataccatgtac |
37 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
4665694 |
taaataattcttttgctcctataccatgtac |
4665664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University