View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9565_low_7 (Length: 292)
Name: NF9565_low_7
Description: NF9565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9565_low_7 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 46 - 292
Target Start/End: Complemental strand, 34142129 - 34141881
Alignment:
| Q |
46 |
gttagaggagcctcttgattcacc--aagtaatcatctcagttataatttcaggtgaaaagaagaaaatgccaatggaaatgactcccaatttgttcatt |
143 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34142129 |
gttagaggagcctcttgattcccccgaagtaatcatctcagttataatttcaggtgtaaagaagaaaatgccaatggaaatgactcccaatttgttcatt |
34142030 |
T |
 |
| Q |
144 |
tgcaatgaaaaattgaatgcaacaggtatgtttatcattattattacatgtggcttcatgcaattgtatgcgcttacattaaccttttgattgcagggcc |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
34142029 |
tgcaatgaaaaattgaatgcaacaggtatgtttatcattattattacatgtggcttcatgcaattgtacgcgcttacattaaccttttgattgcagggcc |
34141930 |
T |
 |
| Q |
244 |
gccagagattattattaagaaagagtataatgaagatgaaactgtgacc |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34141929 |
gccagagattattattaagaaagagtataatgaagatgaaactgtgacc |
34141881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University