View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9566_high_4 (Length: 263)
Name: NF9566_high_4
Description: NF9566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9566_high_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 6 - 246
Target Start/End: Complemental strand, 18739295 - 18739056
Alignment:
| Q |
6 |
gtttggagtttaaattccgattctttcactcaagtgtatgagtctcgtctcagttgctgttttcatctcctctatctaccnnnnnnnnnnnnnnnnnnca |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
18739295 |
gtttggagtttaaattccgattctttcactcaagtgtatgagtctcgtctcagttgctgttttcatctcctctatctacc-aaaaagaaaaagaaaaaca |
18739197 |
T |
 |
| Q |
106 |
ttccacaaagtaattttgatagtcaaaaaacaatgagtactaannnnnnnagtaagacaatgctatatggtacagannnnnnnnccgacgaaaatacacg |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
18739196 |
ttccacaaagtaattttgatagtcaaaaaacaatgagtactaatttttttagtaagacaatgctatatggtacagattttttttccgacgaaaatacacg |
18739097 |
T |
 |
| Q |
206 |
aatgtgtgtaattgatgcacttgactacactttttaatatc |
246 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
18739096 |
aatgtgtgtaattgatgcacttgactacaatttttaatatc |
18739056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University