View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9566_low_1 (Length: 336)
Name: NF9566_low_1
Description: NF9566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9566_low_1 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 302; Significance: 1e-170; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 14 - 319
Target Start/End: Original strand, 41382965 - 41383270
Alignment:
| Q |
14 |
caaagggaaagggaaatggggcgacgaaatcggagaataggactatgagaacgacatttatcaagcaaaacggatacaaagattgtggacacatttgcaa |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41382965 |
caaagggaaagggaaatggggcgacgaaattggagaataggactatgagaacgacatttatcaagcaaaacggatacaaagattgtggacacatttgcaa |
41383064 |
T |
 |
| Q |
114 |
gtttgcaatggataagtatctttcaaattcaataggcccccacaatgctcacaatttgcatttatgctttatgctttatactgccttacccatggattcc |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41383065 |
gtttgcaatggataagtatctttcaaattcaataggcccccacaatgctcacaatttgcatttatgctttatgctttatactgccttacccatggattcc |
41383164 |
T |
 |
| Q |
214 |
cacgaattgcaattcgacaaacaaaaacttaccttttgatttcttgtcatcatttgctgttaacaacactatgcaaatatgtatgatcaatttagtagcc |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41383165 |
cacgaattgcaattcgacaaacaaaaacttaccttttgatttcttgtcatcatttgctgttaacaacactatgcaaatatgtatgatcaatttagtagcc |
41383264 |
T |
 |
| Q |
314 |
aaattg |
319 |
Q |
| |
|
|||||| |
|
|
| T |
41383265 |
aaattg |
41383270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University